Molecular detection of equine herpes virus-1 in local horses (Equus feruscaballus) and donkeys (Equus asinus)
العناوين الأخرى
الكشف الجزيئي عن فيروس هربز الخيول نمط 1 في الخيول و الحمير المحلية
المؤلف
المصدر
Iraqi Journal of Veterinary Medicine
العدد
المجلد 42، العدد 1 (30 يونيو/حزيران 2018)، ص ص. 72-78، 7ص.
الناشر
تاريخ النشر
2018-06-30
دولة النشر
العراق
عدد الصفحات
7
التخصصات الرئيسية
الملخص EN
Equine herpsvirus type1 was classified as a member of the subfamily Alphaherpesvirinae.
It was reported to cause respiratory, reproductive and neurologic infection in horses.
The reproductive form of the disease induces abortion in pregnant mare, while the neurologic form is associated with paralysis of infected horses.
This study was designed for molecular detection of Equine herpsvirus type1 by polymerase chain reaction.
Blood buffy coat samples were collected from 25 horses (Equus feruscaballus) and 25 donkeys (Equus asinus) admitted to local private veterinary clinics around Baghdad and Baaquba cities.
DNA was extracted from such samples by the use of DNA extraction kit of COLLECTAGENET .The samples were subjected to conventional PCR test using specific primers for gB gene of equine herepesvirus-1.
Forward primer (F) (5’ TAACTGAGATCT AACCGAC 3’) and reverse primer (R) (CATATATAGCTATCACGTCC 3’).
One buffy coat sample from aborted mare and one buffy coat sample from a donkey suffering from acute respiratory clinical signs were inoculated in mice to follow the fate of equine herepesvirus-1in nasal turbinates, cervical lymph nodes and lungs of these mice.
The results showed that only 4 samples from horses and 2 samples from donkeys were positive to polymerase chain reaction.
Experimentally infected mice did not show any clinical signs but they were positive to polymerase chain reaction, and the virus easily terminated, probably due to low dose of the virus and host specificity.
It can be concluded that local horses and donkeys, somewhere have had infected with equine herepesvirus-1, and became latent carriers for the virus.
Furthermore, microbiological and epidemiological studies on local Equine herpsvirus type1 and Equine herpsvirus type 4 are recommended
نمط استشهاد جمعية علماء النفس الأمريكية (APA)
al-Ujayli, Karim Sadun Ali. 2018. Molecular detection of equine herpes virus-1 in local horses (Equus feruscaballus) and donkeys (Equus asinus). Iraqi Journal of Veterinary Medicine،Vol. 42, no. 1, pp.72-78.
https://search.emarefa.net/detail/BIM-897314
نمط استشهاد الجمعية الأمريكية للغات الحديثة (MLA)
al-Ujayli, Karim Sadun Ali. Molecular detection of equine herpes virus-1 in local horses (Equus feruscaballus) and donkeys (Equus asinus). Iraqi Journal of Veterinary Medicine Vol. 42, no. 1 (2018), pp.72-78.
https://search.emarefa.net/detail/BIM-897314
نمط استشهاد الجمعية الطبية الأمريكية (AMA)
al-Ujayli, Karim Sadun Ali. Molecular detection of equine herpes virus-1 in local horses (Equus feruscaballus) and donkeys (Equus asinus). Iraqi Journal of Veterinary Medicine. 2018. Vol. 42, no. 1, pp.72-78.
https://search.emarefa.net/detail/BIM-897314
نوع البيانات
مقالات
لغة النص
الإنجليزية
الملاحظات
Includes bibliographical references : p. 76-77
رقم السجل
BIM-897314
قاعدة معامل التأثير والاستشهادات المرجعية العربي "ارسيف Arcif"
أضخم قاعدة بيانات عربية للاستشهادات المرجعية للمجلات العلمية المحكمة الصادرة في العالم العربي
تقوم هذه الخدمة بالتحقق من التشابه أو الانتحال في الأبحاث والمقالات العلمية والأطروحات الجامعية والكتب والأبحاث باللغة العربية، وتحديد درجة التشابه أو أصالة الأعمال البحثية وحماية ملكيتها الفكرية. تعرف اكثر