First appearance of the cave leech Erpobdella mestrovi (Annelida: Erpobdillidae)‎ in Iraq (morphological and molecular investigation)‎ from Zalm stream, Sulaimani province, Kurdistan region, Iraq

Abstract EN

During survey of different water bodies in Kurdistan Region, Iraq for the presence of leeches, only two distinct specimens with special morphological characters were found in the cave mouth of Ahmadawa Water source in February 2019.

The morphological (Body size, oral and posterior suckers characters, coloration and body projections were studied) and molecular study (18S rDNA amplifying with a forward primer C1 (ACCCGCTGAATTTAAGCAT at position 25), and reverse primer C3 (CTCTTCAGAGTACTTTTCAAC at position 390) and sequencing of the amplicons) cleared that the present specimens were belonging to the erpobdillid leeches, Erpobdella mestrovi, and the present appearance regard as a first in Iraq and all over the Middle-East for this leech.